Quick Order

Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BIRC2cDNA Clone Product Information
Gene_bank_ref_id:NM_001166.3
cDNA Size:1857
cDNA Description:ORF Clone of Homo sapiens baculoviral IAP repeat-containing 2 DNA.
Gene Synonym:API1, MIHB, HIAP2, RNF48, cIAP1, Hiap-2
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11090-ACG$345
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11090-ACR$345
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11090-ANG$345
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11090-ANR$345
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11090-CF$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11090-CH$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11090-CM$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11090-CY$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone)HG11090-M$115
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11090-M-F$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11090-M-N$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11090-NF$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11090-NH$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11090-NM$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11090-NY$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11090-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

The cellular inhibitor of apoptosis protein-1 (cIAP1) is a member of the Inhibitor of Apoptosis family proteinsare (IAP) whose members are characterized by a novel domain of about 70 amino acids termed baculoviral IAP repeats (BIRs). The BIR domains of cIAP1 and cIAP2 bind to caspases, the key effector proteases of apoptosis. The IAP protein family which can enhance cell survival are crucial regulators of programmed cell death. Both cIAP1 and cIAP2 are the E3 ubiquitin protein isopeptide ligases for Smac, taking part in promoting cancer survival through functioning as E3 ubiqitin ligases. Removal of cIAP1 by genetic deletion may result in NF-κB signaling activation that induces TNFα production and in killing sensitive tumor cells through enhanced TNF-R1 death-receptor signaling and caspase 8 activation. The substrate-dependent E3 activity of cIAPs is mediated by their RING domains and is dependent on the specific interactions between cIAPs and Smac. cIAP1 and cIAP2 are also reported to be regulators of NF-kB activation upon TNFαtreatment.

References
  • Vince JE, et al. (2007) IAP Antagonists Target cIAP1 to Induce TNF-Dependent Apoptosis. Cell. 131(4): 682-93.
  • Hu SM, et al. et al. (2003) Cellular Inhibitor of Apoptosis 1 and 2 Are Ubiquitin Ligases for the Apoptosis Inducer Smac/DIABLO. The Journal of Biological Chemistry. 278: 10055-60.
  • Imoto I, et al. (2011) Identification of cIAP1 As a Candidate Target Gene within an Amplicon at 11q22 in Esophageal Squamous Cell Carcinomas 1. Cancer Res. 61: 6629.
  • Size / Price
    Catalog:HG11090-CF
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"