Quick Order

Text Size:AAA

Human PADI4 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PADI4 cDNA Clone Product Information
NCBI RefSeq:NM_012387.2
RefSeq ORF Size:1992bp
cDNA Description:Full length Clone DNA of Homo sapiens peptidyl arginine deiminase, type I V with C terminal Flag tag.
Gene Synonym:PAD, PAD4, PDI4, PDI5, PADI5, PADI4
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Protein-arginine deiminase type-4, also known as HL-60 PAD, Peptidylarginine deiminase IV, Protein-arginine deiminase type I V and PADI4, is a cytoplasm and nucleus protein which belongs to the protein arginine deiminase family. PADI4 is expressed in CD34+ stem cells in normal tissues, and many more CD34+ cells expressing PADI4 are present in tumour tissues. PADI4 post-translationally converts peptidylarginine to citrulline, a process called citrullination. Studies have demonstrated the high expression of PADI4 in various malignant tumour tissues. PADI4 is also expressed at high levels in the blood of patients with some malignant tumours. Citrullination of histone, cytokeratin, antithrombin and fibronectin have been confirmed to be involved in abnormal apoptosis, high coagulation, and disordered cell proliferation and differentiation, all of which are main features of malignant tumours. PADI4 may play an important role in tumourigenesis. Genetic variations in PADI4 are a cause of susceptibility to rheumatoid arthritis (RA). It is a systemic inflammatory disease with autoimmune features and a complex genetic component. It primarily affects the joints and is characterized by inflammatory changes in the synovial membranes and articular structures, widespread fibrinoid degeneration of the collagen fibers in mesenchymal tissues, and by atrophy and rarefaction of bony structures.

References
  • Nakashima K. et al.,1999, J. Biol. Chem. 274: 27786-92.
  • Suzuki A. et al., 2003, Nat. Genet. 34:395-402.
  • Nakayama-Hamada M. et al., 2005, Biochem. Biophys. Res. Commun. 327:192-200.
  • Chang, X. et al., 2010, Cancer Cell Int  10:7.
  • Size / Price
    Catalog: HG11072-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"