After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse PTGDS natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PTGDS cDNA Clone Product Information
Gene_bank_ref_id:NM_008963.2
RefSeq ORF Size:570bp
cDNA Description:Full length Clone DNA of Mus musculus prostaglandin D2 synthase (brain).
Gene Synonym:PGD2, PGDS, 21kDa, PGDS2, Ptgs3, L-PGDS
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

PTGDS, also known as L-PGDS, belongs to the calycin superfamily,lipocalin family. Lipocalins share limited regions of sequence homology and a common tertiary structure architecture. They transport small hydrophobic molecules such as steroids, bilins, retinoids, and lipids. PTGDS is a glutathione-independent prostaglandin D synthase that catalyzes the conversion of PGH2 to PGD2. It is involved in smooth muscle contraction/relaxation and a variety of central nervous system functions. PTGDS may have an anti-apoptotic role in oligodendrocytes. It binds small non-substrate lipophilic molecules, including biliverdin, bilirubin, retinal, retinoic acid and thyroid hormone, and may act as a scavenger for harmful hydrophopic molecules and as a secretory retinoid and thyroid hormone transporter. It is likely to play important roles in both maturation and maintenance of the central nervous system and male reproductive system.

References
  • Aebersold R, et al. (1993) Identification of a brain-specific human cerebrospinal fluid glycoprotein, beta-trace protein. Theor Electrophor. 3:229-234.
  • Oliver K, et al. (2004) DNA sequence and analysis of human chromosome 9. Nature. 429:369-374.
  • Bonaldo MF, et al. (1997) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res. 6(9):791-806.
  • Size / Price
    Catalog: MG51472-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"