Quick Order

Human CHST15 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CHST15cDNA Clone Product Information
cDNA Size:1686
cDNA Description:ORF Clone of Homo sapiens carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 DNA.
Gene Synonym:KIAA0598, MGC34346, RP11-47G11.1, DKFZp781H1369
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Carbohydrate sulfotransferase 15, also known as N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase, GalNAc4S-6ST, B-cell RAG-associated gene protein, CHST15 and BRAG, is a single-pass type I I membrane protein which belongs to the sulfotransferase 1 family. CHST15 / BRAG is expressed in B-cell-enriched tissues but not in fetal or adult thymus. It is expressed in fetal and adult spleen, lymph node, tonsil, bone marrow and peripheral leukocytes. It is not expressed in T-cells. In pro-B, pre-B, and mature B-cell lines, it colocalizes with RAG1. CHST15 / BRAG is a sulfotransferase that transfers sulfate from 3'-phosphoadenosine 5'-phosphosulfate (PAPS) to the C-6 hydroxyl group of the GalNAc 4-sulfate residue of chondroitin sulfate A and forms chondroitin sulfate E containing GlcA-GalNAc(4,6-SO4) repeating units. It also transfers sulfate to a unique non-reducing terminal sequence, GalNAc(4SO4)-GlcA(2SO4)-GalNAc(6SO4), to yield a highly sulfated structure similar to the structure found in thrombomodulin chondroitin sulfate. CHST15 / BRAG may also act as a B-cell receptor involved in BCR ligation-mediated early activation that mediate regulatory signals key to B-cell development and / or regulation of B-cell-specific RAG expression.

Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items