After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HK3cDNA Clone Product Information
Gene_bank_ref_id:NM_002115.2
cDNA Size:2772
cDNA Description:ORF Clone of Homo sapiens hexokinase 3 (white cell) DNA.
Gene Synonym:HXK3, HKIII
Species:Human
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11016-ACG$425
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11016-ACR$425
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11016-ANG$425
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11016-ANR$425
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11016-CF$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11016-CH$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11016-CM$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11016-CY$395
Human HK3 Gene cDNA Clone (full-length ORF Clone)HG11016-M$145
Human HK3 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG11016-M-F$395
Human HK3 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG11016-M-N$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11016-NF$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11016-NH$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11016-NM$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11016-NY$395
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11016-UT$395
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Hexokinase-3, also known as Hexokinase type III, HKIII and HK3, is a protein which belongs to the hexokinase family. Hexokinase-3 / HK3 is an enzyme which in humans is encoded by the HK2 gene. Hexokinases phosphorylate glucose to produce glucose 6-phosphate, committing glucose to the glycolytic pathway. In mammalian tissues hexokinase exists as four isoenzymes encoded by distinct genes. These proteins are homologous and are organized in two homologous domains, with the exception of hexokinase type IV which has only one. This organization is believed to be the result of a duplication and tandem fusion event involving the gene encoding for the ancestral hexokinase. The gene encodes hexokinase-3. Similar to hexokinases-1 and hexokinases-2, this allosteric enzyme is inhibited by its product glucose 6-phosphate.

References
  • Palma F. et al., 1996, Mol Cell Biochem. 155: 23-9.
  • Furuta H. et al.,1996, Genomics. 36 (1): 206-9.
  • Colosimo A. et al.,1996, Cytogenet Cell Genet. 74 (3): 187-8.
  • Size / Price
    Catalog:HG11016-CF
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"