After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EEF1B2cDNA Clone Product Information
cDNA Size:678
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) eukaryotic translation elongation factor 1 beta 2 DNA.
Gene Synonym:EEF1B2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedCG90457-ACG$325
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagCG90457-ACR$325
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedCG90457-ANG$325
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagCG90457-ANR$325
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedCG90457-CF$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedCG90457-CH$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedCG90457-CM$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedCG90457-CY$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone)CG90457-G$95
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedCG90457-NF$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedCG90457-NH$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedCG90457-NM$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedCG90457-NY$295
Cynomolgus monkey EEF1B2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedCG90457-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

EF1B, also known as EEF1B2, is a translation elongation factor. It belongs to the EF-1-beta/EF-1-delta family. Elongation factors are a set of proteins that are used in protein synthesis in the cell. In the ribosome, they facilitate translational elongation, from the formation of the first peptide bond to the formation of the last one. EF1B is more complex in eukaryotes than in bacteria, and consists of three subunits: EF1B-alpha, EF1B-gamma and EF1B-beta. EF1B contains 1 GST C-terminal domain. It is involved in the transfer of aminoacylated tRNAs to the ribosome. EF1B is required to regenerate EF1A from its inactive form (EF1A-GDP) to its active form (EF1A-GTP). EF1A is then ready to interact with a new aminoacyl-tRNA to begin the cycle again.

  • Pizzuti A. et al., 1994, Biochem Biophys Res Commun. 197 (1): 154-62.
  • Rual. et al., 2005, Nature. 437 (7062): 1173-8.
  • Stelzl. et al., 2005, Cell. 122 (6): 957-68.
  • Sang Lee. et al., 2002, Biochem Biophys Res Commun. 291 (1): 158-64.