Quick Order

Mouse CREG1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CREG1cDNA Clone Product Information
cDNA Size:663
cDNA Description:ORF Clone of Mus musculus cellular repressor of E1A-stimulated genes 1 DNA.
Gene Synonym:Creg, AA755314, Creg1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

CREG1 belongs to the CREG family. It is a adenovirus E1A protein which both activates and represses gene expression to promote cellular proliferation and inhibit differentiation. Thus it may contribute to the transcriptional control of cell growth and differentiation. The transcriptional control activity of cell growth requires interaction with IGF2R. CREG1 also antagonizes transcriptional activation and cellular transformation by E1A. It shares limited sequence similarity with E1A and binds both the general transcription factor TBP and the tumor suppressor pRb in vitro. CREG1 gene may contribute to the transcriptional control of cell growth and differentiation.

  • Veal E, et al. (2000) The secreted glycoprotein CREG enhances differentiation of NTERA-2 human embryonal carcinoma cells. Oncogene. 19(17):2120-8.
  • Wen SJ, et al. (2003) Screening the proteins that interact with calpain in a human heart cDNA library using a yeast two-hybrid system. Hypertens Res. 25(4):647-52.
  • Grouse LH, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items