After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse IGSF8 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse IGSF8 cDNA Clone Product Information
NCBI RefSeq:AF439263.1
RefSeq ORF Size:1836bp
cDNA Description:Full length Clone DNA of Mus musculus immunoglobulin superfamily, member 8.
Gene Synonym:PGRL; EWI-2; KCT-4; ESTM34; R75384; AA033172; AU041109
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Glazar AI, et al. (2009) Immunoglobulin superfamily member IgSF8 (EWI-2) and CD9 in fertilisation: evidence of distinct functions for CD9 and a CD9-associated protein in mammalian sperm-egg interaction. Reprod Fertil Dev. 21(2): 293-303.
  • Murdoch JN, et al. (2003) Genomic organization and embryonic expression of Igsf8, an immunoglobulin superfamily member implicated in development of the nervous system and organ epithelia. Mol Cell Neurosci. 22(1): 62-74.
  • Zhang XA, et al. (2003) EWI2/PGRL associates with the metastasis suppressor KAI1/CD82 and inhibits the migration of prostate cancer cells. Cancer Res. 63 (10): 2665-74.
  • Size / Price
    Catalog: MG51042-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"