Quick Order

Human PVRL3 / PRR3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PVRL3cDNA Clone Product Information
cDNA Size:1689
cDNA Description:ORF Clone of Homo sapiens poliovirus receptor-related 3 DNA.
Gene Synonym:PPR3, PRR3, CD113, PVRR3, CDw113, FLJ90624, nectin-3, DKFZp566B0846, PVRL3
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Poliovirus receptor-related 3 (PVRL3), also known as Nectin-3 and CD113, is a member of the nectin family. PVRL3/Nectin-3 is an 83 kDa, type I transmembrane glycoprotein. Its precursor is 549 amino acids (aa) in length and contains an extended signal sequence of 57 aa, an extracellular domain (ECD) of 347 aa, a transmembrane segment of 21 aa, and a cytoplasmic region of 124 aa. Nectin-3 has three splicing variants, nectin-3alpha (biggest), -3beta (middle), and -3gamma (smallest). It is predominantly expressed in testis and placenta as well as in various cell lines, including epithelial cell lines. PVRL3/Nectin-3 plays a role in cell-cell adhesion through heterophilic trans-interactions with nectin-like proteins or nectins, such as trans-interaction with PVRL2/Nectin-2 at Sertoli-spermatid junctions. PVRL3/Nectin-3 is thus involved in the formation of cell-cell junctions, including adherens junctions and synapses. It has been shown to induce endocytosis-mediated down-regulation of PVR from the cell surface, resulting in reduction of cell movement and proliferation.

  • Satoh-Horikawa, et al. (2000). Nectin-3, a new member of immunoglobulin-like cell adhesion molecules that shows homophilic and heterophilic cell-cell adhesion activities. J Biol Chem (UNITED STATES) . 275 (14): 10291-9.
  • Reymond N, et al. (2000). Human nectin3/PRR3: a novel member of the PVR/PRR/nectin family that interacts with afadin. Gene (NETHERLANDS). 255 (2): 347-55.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human PVRL3 / PRR3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged