Quick Order

Mouse MMP14 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse MMP14 cDNA Clone Product Information
Gene_bank_ref_id:NM_008608.3
RefSeq ORF Size:1749bp
cDNA Description:Full length Clone DNA of Mus musculus matrix metallopeptidase 14 (membrane-inserted).
Gene Synonym:MT1-MMP, AI325305, MT-MMP-1, Mmp14
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mMMP14
Restriction Site:HindIII + XbaI (6.1kb + 1.75kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 540G>A, 750C>T, 753T>C, 1119G>A, 1218G>T, 1392G>A, 1491T>C, 1623C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse MMP14 Gene Plasmid Map
Mouse MMP14 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: MG51026-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"