After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human YWHAE Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
YWHAEcDNA Clone Product Information
Gene Bank Ref.ID:NM_006761.4
cDNA Size:768
cDNA Description:ORF Clone of Homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide DNA.
Gene Synonym:MDS, MDCR, KCIP-1, 14-3-3E, FLJ45465, YWHAE
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

YWHAE, also known as 14-3-3 epsilon, mediate signal transduction by binding to phosphoserine-containing proteins. 14-3-3 epsilon / YWHAE is a member of the 14-3-3 proteins family. 14-3-3 proteins are a group of highly conserved proteins that are involved in many vital cellular processes such as metabolism, protein trafficking, signal transduction, apoptosis and cell cycle regulation. 14-3-3 proteins are mainly localized in the synapses and neuronal cytoplasm, and seven isoforms have been identified in mammals. This family of proteins was initially identified as adaptor proteins which bind to phosphoserine-containing motifs. Binding motifs and potential functions of 14-3-3 proteins are now recognized to have a wide range of functional relevance. 14-3-3 epsilon / YWHAE is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. YWHAE interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. It has also been implicated in the pathogenesis of small cell lung cancer. 14-3-3 epsilon / YWHAE is implicated in the regulation of a large spectrum of both general and specialized signaling pathways. 14-3-3 epsilon / YWHAE Binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif. This Binding generally results in the modulation of the activity of the binding partner.

  • Ikeda M, et al. (2008) Identification of YWHAE, a gene encoding 14-3-3epsilon, as a possible susceptibility gene for schizophrenia. Hum Mol Genet. 17(20): 3212-22.
  • Mignon-Ravix C, et al. (2010) Deletion of YWHAE in a patient with periventricular heterotopias and pronounced corpus callosum hypoplasia. J Med Genet. 47(2): 132-6.
  • Nagamani SC, et al. (2009) Microdeletions including YWHAE in the Miller-Dieker syndrome region on chromosome 17p13.3 result in facial dysmorphisms, growth restriction, and cognitive impairment. J Med Genet. 46(12): 825-33.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks