Quick Order

Mouse METAP1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse METAP1 cDNA Clone Product Information
Gene_bank_ref_id:NM_175224.4
RefSeq ORF Size:1161bp
cDNA Description:Full length Clone DNA of Mus musculus methionyl aminopeptidase 1.
Gene Synonym:METAP1
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Processing of the N-terminal initiator methionine or formylated methionine is an essential cellular process conserved from prokaryotes to eukaryotes. The proteolytic removal of N-terminal methionine from nascent peptides is catalyzed by a family of enzymes known as methionine aminopeptidases (MetAPs) and is essential for cell growth. METAP1 and METAP2 have different substrate specificity due to the differences in both size and shape of the active sites. As a member of the M24 family of metalloproteases, METAP1 plays an important role in G(2)/M phase regulation of the cell cycle and may serve as a promising target for the discovery and development of new anticancer agents.

References

1. Lowther, W.T. and B.W. Matthews, 2000, Biochim. Biophys. Acta. 1477: 157 – 167.

2. Addlaqatta, A. et al., 2005, Biochemistry. 44: 14741-14749.

3. Hu, X. et al., 2006, Proc. Natl. Acad. Sci. U.S.A. 103:18148-18153.

Size / Price
Catalog: MG50999-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"