Quick Order

Mouse KLK-4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KLK4cDNA Clone Product Information
cDNA Size:768
cDNA Description:ORF Clone of Mus musculus kallikrein related-peptidase 4 DNA.
Gene Synonym:PSTS, ESMP1, KLK-L1, Prss17, Klk4
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Kallikrein-4, also known as Enamel matrix serine proteinase 1, Kallikrein-like protein 1, KLK-L1, Serine protease 17, KLK4, PRSS17 and EMSP1, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. Kallikrein-4 / KLK4 is a serine protease expressed during enamel maturation, and proteolytic processing of the enamel matrix by KLK4 is critical for proper enamel formation. Kallikrein-4 / KLK4 contains one peptidase S1 domain. Kallikrein-4 / KLK4 is secreted by transition- and maturation-stage ameloblasts. KLK4 aggressively degrades the retained organic matrix following the termination of enamel protein secretion. Two proteases are secreted into the enamel matrix of developing teeth. The early protease is enamelysin (MMP-20). The late protease is kallikrein 4 (KLK4). The principle functions of MMP-20 and KLK4 in dental enamel formation are to facilitate the orderly replacement of organic matrix with mineral, generating an enamel layer that is harder, less porous, and unstained by retained enamel proteins. Defects in Kallikrein-4 / KLK4 are the cause of amelogenesis imperfecta hypomaturation type 2A1 (AI2A1) which is an autosomal recessive defect of enamel formation. The disorder involves both primary and secondary dentitions.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items