Quick Order

Mouse DPP10 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse DPP10 cDNA Clone Product Information
Gene_bank_ref_id:NM_199021.3
RefSeq ORF Size:2403bp
cDNA Description:Full length Clone DNA of Mus musculus dipeptidylpeptidase 10.
Gene Synonym:DPPX, Dprp3, 6430601K09Rik, Dpp10
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Inactive dipeptidyl peptidase 10, also known as Dipeptidyl peptidase IV-related protein 3, Dipeptidyl peptidase X, Dipeptidyl peptidase-like protein 2, DPRP-3, DPL2 and DPP10, is a single-pass type I I membrane protein which belongs to the peptidase S9B family. DPPIV subfamily. It may modulate cell surface expression and activity of the potassium channels KCND1 and KCND2. DPP10 / DPRP3 has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Genetic variations in DPP10 are associated with susceptibility to asthma (ASTHMA). The most common chronic disease affecting children and young adults. It is a complex genetic disorder with a heterogeneous phenotype, largely attributed to the interactions among many genes and between these genes and the environment. It is characterized by recurrent attacks of paroxysmal dyspnea, with weezing due to spasmodic contraction of the bronchi.

References
  • Nagase T., et al., 2000, DNA Res. 7:143-150.
  • Allen M., et al., 2003, Nat. Genet. 35:258-263.
  • Qi SY, et al.,2003, Biochem J 373 (Pt 1): 179-89. 
  • Chen T., et al., 2003, Adv. Exp. Med. Biol. 524:79-86.
  • Zagha E., et al., 2005, J. Biol. Chem. 280:18853-61.
  • Size / Price
    Catalog: MG50987-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"