Quick Order

Text Size:AAA

Mouse CDH6 / KCAD Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDH6cDNA Clone Product Information
cDNA Size:2373
cDNA Description:ORF Clone of Mus musculus cadherin 6 DNA.
Gene Synonym:cad6, MGC129338, MGC129360, K-cadherin, cadherin-6, Cdh6
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Cadherins are a family of calcium-dependent, cell-cell adhesion molecules that play an important morphoregulatory role in a wide variety of tissues. Alterations in cadherin function have been implicated in tumor progression in a number of adenocarcinomas. Cadherin-6 (CDH6), also known as K-cadherin (KCAD), is a type-II classic cadherin cell-cell adhesion molecules, which are expressed in graded or areal patterns, as well as layer-specific patterns, in the cortical plate. Human Cadherin-6 is synthesized as a 790 aa type I transmembrane glycoprotein that contains a 18 aa signal peptide, a 35 aa propeptide, a 562 aa extracellular region, a 21 aa transmembrane segment, and a 154 aa cytoplasmic domain. There are five cadherin domains of approximately 110 aa each in the extracellular region. Cadherin-6 is highly expressed in brain, cerebellum, and kidney, and may contribute to the formation of the segmental structure of the early brain, as well as the development of renal proximal tubules. Weak expression is also detected lung, pancreas, and gastric mucosa. Additionally, it is specifically expressed in the proximal tubule of normal kidneys and in renal cell cancer. Thus , Cadherin-6 is a new prognostic factor for renal cancer.

  • Paul R, et al. (1997) Cadherin-6, a cell adhesion molecule specifically expressed in the proximal renal tubule and renal cell carcinoma. Cancer Res. 57(13): 2741-8.
  • Paul R, et al. (2004) Cadherin-6: a new prognostic marker for renal cell carcinoma. J Urol. 171(1): 97-101.
  • Taniguchi H, et al. (2006) Classic cadherins regulate tangential migration of precerebellar neurons in the caudal hindbrain. Development. 133(10): 1923-31.
  • Liu Q, et al. (2006) cadherin-6 message expression in the nervous system of developing zebrafish. Dev Dyn. 235(1): 272-8.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items