After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CPB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CPB2cDNA Clone Product Information
Gene_bank_ref_id:NM_019775.3
cDNA Size:1269
cDNA Description:ORF Clone of Mus musculus carboxypeptidase B2 (plasma) DNA.
Gene Synonym:CPR, Cpu, TAFI, AI255929, MGC107573, 1110032P04Rik, 4930405E17Rik, Cpb2
Species:Mouse
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Carboxypeptidase B2, also known as Carboxypeptidase U, Thrombin-activable fibrinolysis inhibitor, Plasma carboxypeptidase B, CPB2, is a secreted protein which belongs to the peptidase M14 family. Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). CPB2 is activated by thrombin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. CPB2 is synthesized by the liver and circulates in the plasma as a plasminogen-bound zymogen. When it is activated by proteolysis at residue Arg92 by the thrombin / thrombomodulin complex. CPB2 cleaves C-terminal arginine or lysine residues from biologically active peptides such as kinins or anaphylatoxins in the circulation thereby regulating their activities. CPB2 exhibits carboxypeptidase activity and activated CPB2 reduces fibrinolysis by removing the fibrin C-terminal residues that are important for the binding and activation of plasminogen.

References
  • Eaton DL. et al.,1991, J Biol Chem. 266 (32): 21833-8.
  • Boffa MB. et al.,1999, Biochemistry. 38 (20): 6547-58.
  • Liu T. et al., 2005, J. Proteome Res. 4: 2070-80.
  • Valnickova Z. et al., 2006, Biochemistry. 45: 1525-35.
  • Chen R. et al., 2009, J. Proteome Res. 8: 651-61.
  • Size / Price
    Catalog:MG50963-UT
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"