Quick Order

Mouse CNDP1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse CNDP1 cDNA Clone Product Information
NCBI RefSeq:NM_177450.4
RefSeq ORF Size:1479bp
cDNA Description:Full length Clone DNA of Mus musculus carnosine dipeptidase 1 (metallopeptidase M20 family).
Gene Synonym:Cn1, AI746433, Cndp1
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CNDP1, also known as carnosine dipeptidase 1, glutamate carboxypeptidase-like protein 2 (CPGL-2) or carnosinase 1 (CN1), is a member of the M20 metalloprotease family. The CNDP1 gene contains trinucleotide (CTG) repeat length polymorphism in the coding region, which has been demonstrated to be associated with susceptibility to developing diabetic nephropathy, for carnosine protection against the adverse effects of high glucose levels on renal cells. In humans, CNDP1 is secreted from the liver into the serum. In other mammals, including rodents, CNDP1 is expressed exclusively within the kidney and lacks a signal peptide. CNDP1 protein is a secreted homodimeric dipeptidase that specifically hydrolyzes L-carnosine (β-alanyl-L-histidine), and is identified as human carnosinase expressed in the brain. CNDP1 has been associated with diabetic nephropathy in Europeans and European Americans, but not African-Americans. It was identified and confirmed as a risk factor, were cross-sectional and mostly in patients with type 2 diabetes. The polymorphisms of CNDP1 can be excluded as a risk factor for nephropathy in type 1 diabetes. In addition, CNDP1 is also suggested to be implicated in the actions of neuroprotection and neurotransmiting.

References
  • Teufel M, et al. (2003) Sequence identification and characterization of human carnosinase and a closely related non-specific dipeptidase. J Biol Chem 278(8):6521-31.
  • Janssen B, et al. (2005) Carnosine as a protective factor in diabetic nephropathy: association with a leucine repeat of the carnosinase gene CNDP1. Diabetes 54(8):2320-7.
  • Riedl E, et al. (2007) A CTG polymorphism in the CNDP1 gene determines the secretion of serum carnosinase in Cos-7 transfected cells. Diabetes 56(9):2410-3.
  • Freedman BI, et al. (2007) A leucine repeat in the carnosinase gene CNDP1 is associated with diabetic end-stage renal disease in European Americans. Nephrol Dial Transplant 22(4):1131-5.
  • Wanic K, et al. (2008) Exclusion of polymorphisms in carnosinase genes (CNDP1 and CNDP2) as a cause of diabetic nephropathy in type 1 diabetes: results of large case-control and follow-up studies. Diabetes 57(9):2547-51.
  • McDonough CW, et al. (2009) The influence of carnosinase gene polymorphisms on diabetic nephropathy risk in African-Americans. Hum Genet. 126(2):265-75.
  • Size / Price
    Catalog: MG50959-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"