Quick Order

Text Size:AAA

Cynomolgus monkey LAMP3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LAMP3cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:1251
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) lysosomal-associated membrane protein 3 DNA.
Gene Synonym:LAMP3
Species:Cynomolgus
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

Dendritic cell-lysosomal associated membrane protein (DC-LAMP)/CD208, also known as LAMP3, is a member of the lysosomal associated membrane protein (LAMP) family, which is specifically expressed by human dendritic cells (DCs) upon activation and therefore serves as marker of human DC maturation. Confocal and immunoelectron microscopy showed that mouse DC-LAMP protein co-localizes with lbm180, a specific marker for the limiting membrane of lamellar bodies that contain surfactant protein B. The present study demonstrates that DC-LAMP is constitutively expressed by mouse, sheep, and human type II pneumocytes. DC-LAMP is constitutively expressed in normal type II pneumocytes. DC-LAMP is detected first in activated human DC within MHC class II molecules-containing compartments just before the translocation of MHC class II-peptide complexes to the cell surface, suggesting a possible involvement in this process. Furthermore, overexpression of LAMP3 is actively involved in tumor invasion through increased migration into lymph-vascular spaces.

References
  • Salaun B, et al. (2003) Cloning and characterization of the mouse homologue of the human dendritic cell maturation marker CD208/DC-LAMP. Eur J Immunol. 33(9): 2619-29.
  • Salaun B, et al. (2004) CD208/dendritic cell-lysosomal associated membrane protein is a marker of normal and transformed type II pneumocytes. Am J Pathol. 164(3): 861-71.
  • Ishigami S, et al. (2010) Prognostic value of CD208-positive cell infiltration in gastric cancer. Cancer Immunol Immunother. 59(3): 389-95.
  • Size / Price
    Catalog:CG90247-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"