Quick Order

Text Size:AAA

Mouse MANF Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MANFcDNA Clone Product Information
cDNA Size:540
cDNA Description:ORF Clone of Mus musculus mesencephalic astrocyte-derived neurotrophic factor DNA.
Gene Synonym:Armet, D17914, AA407711, AA408789, AA673178, D18Mgi17, 3230402M22Rik, Manf
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Neurotrophin & Receptor Related Products

Mesencephalic astrocyte-derived neurotrophic factor, also known as Protein ARMET, Arginine-rich protein, MANF and ARMET, is a secreted protein which belongs to the ARMET family. ARMET selectively promotes the survival of dopaminergic neurons of the ventral mid-brain. It modulates GABAergic transmission to the dopaminergic neurons of the substantia nigra. ARMET enhances spontaneous, as well as evoked, GABAergic inhibitory postsynaptic currents in dopaminergic neurons. ARMET inhibits cell proliferation and endoplasmic reticulum (ER) stress-induced cell death. The N-terminal region of ARMET may be responsible for neurotrophic activity while the C-terminal region may play a role in the ER stress response. MANF reduces endoplasmic reticulum (ER) stress and has neurotrophic effects on dopaminergic neurons. Intracortical delivery of recombinant MANF protein protects tissue from ischemic brain injury. MANF has been described as a survival factor for dopaminergic neurons. MANF expression was widespread in the nervous system and non-neuronal tissues. In the brain, relatively high MANF levels were detected in the cerebral cortex, hippocampus and cerebellar Purkinje cells. The widespread expression of MANF together with its evolutionary conserved nature and regulation by brain insults suggest that it has important functions both under normal and pathological conditions in many tissue types.

  • Shridhar V., et al., 1996, Oncogene 12:1931-1939.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Petrova P., et al., 2003, J. Mol. Neurosci. 20:173-188.
  • Lindholm, P. et al., 2008, Mol Cell Neurosci. 39 (3):356-71.
  • Airavaara, M. et al., 2010, Exp Neurol. 225 (1):104-13.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items