Quick Order

Text Size:AAA

Human PRSS2 ORF mammalian expression plasmid, C-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRSS2 cDNA Clone Product Information
Gene_bank_ref_id:NM_002770.2
RefSeq ORF Size:744bp
cDNA Description:Full length Clone DNA of Homo sapiens protease, serine, 2 (trypsin 2) with C terminal Flag tag.
Gene Synonym:TRY2, TRY8, TRYP2, MGC111183, MGC120174, PRSS2
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-PRSS2-Flag
Restriction Site:KpnI + XbaI (6kb + 0.79kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 12 T>C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Mouse Trypsin-2, also known as Trypsin II, Anionic trypsinogen, Serine protease 2, PRSS2 and TRY2, is a secreted protein which belongs to the trypsin serine protease family including Trypsin, PRSS1, PRSS2 and PRSS3. It consists of a signal peptide (residues 1-15), a pro region (residues 16-23), and a proteolytically active mature chain (residues 24-247). PRSS2 contains one peptidase S1 domain. It is secreted into the duodenum, hydrolysing peptides into their smaller building blocks, which is necessary for the uptake of protein in the food. It is secreted by the pancreas in the form of inactive zymogen, trypsinogen and cleaved to its active form in the small intestine when the pancreas is stimulated by cholecystokinin through the common activation mechanism.

References
  • Rawlings, N.D. et al.,1994, Meth. Enzymol. 244: 19–61.
  • Noone, P.G. et al., 2001, Gastroenterology. 121 (6): 1310-9.
  • Leiros, H.K. et al., 2004, Protein Sci. 13 (4): 1056–70.
  • Rónai,Z. et al., 2009, Biochem J. 418 (1):155-61.
  • Size / Price
    Catalog: HG10813-CF
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"