After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse NETO1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NETO1cDNA Clone Product Information
cDNA Size:1602
cDNA Description:ORF Clone of Mus musculus neuropilin (NRP) and tolloid (TLL)-like 1 DNA.
Gene Synonym:Btcl1, AI851453, C130005O10Rik, Neto1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Neuropilin tolloid-like 1 (NETO1), a complement C1r/C1s, Uegf, Bmp1 (CUB) domain-containing transmembrane protein, is a novel component of the NMDAR complex critical for maintaining the abundance of NR2A-containing NMDARs in the postsynaptic density. The N-methyl-D-aspartate receptor (NMDAR), a major excitatory ligand-gated ion channel in the central nervous system (CNS), is a principal mediator of synaptic plasticity. Both NETO1 and NETO2 share an identical and unique domain structure thus representing a novel subfamily of CUB- and LDLa-containing proteins. The cytoplasmic domains of NETO1 and NETO2 are not homologous to other known protein sequences but contain a conserved FXNPXY-like motif, which is essential for the internalization of clathrin coated pits during endocytosis or alternatively, may be implicated in intracellular signaling pathways. NETO1 and NETO2, have marked effects on receptor properties, increasing further the potential diversity of Kainate receptors (KARs) functional properties. NETO1 involves in the development and/or maintenance of neuronal circuitry. NETO1 regulates long-term NMDA receptor-dependent synaptic plasticity and cognition, at least in the context of spatial learning and memory.

  • Sthr H, et al. (2002) A novel gene encoding a putative transmembrane protein with two extracellular CUB domains and a low-density lipoprotein class A module: isolation of alternatively spliced isoforms in retina and brain. Gene. 286(2): 223-31.
  • Ng D, et al.d for synaptic plasticity and learning. PLoS Biol. 7(2): e41.
  • Perrais D, et al. (2010) Gating and permeation of kainate receptors: differences unveiled. Trends Pharmacol Sci. 31(11): 516-22.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items