After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CLEC4D natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CLEC4D cDNA Clone Product Information
Gene_bank_ref_id:NM_010819.3
RefSeq ORF Size:660bp
cDNA Description:Full length Clone DNA of Mus musculus C-type lectin domain family 4, member d.
Gene Synonym:mcl, Mpcl, Clecsf8, MGC117678, Clec4d
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

C-type lectin (CLEC) family is a type of carbohydrate-binding protein domain named lectin. C-type lectins are the most diverse and prevalent lectin family in immunity with its requirement for calcium for binding. Proteins including a C-type lectin domain have diverse range of functions including cell-cell adhesion, immune response to pathogens and apoptosis. There are at least 14 types of C-type lectins: typeⅠto typeⅩⅣ. CLEC4D(CLECSF8) is a typeⅡ membrane glycoprotein belonging to the C-type lectin family, with restricted expression in the monocyte/macrophage lineage. It plays important roles in the function of macrophages.

References
  • Johnson KD, et al. (2007) Friend of GATA-1-independent Transcriptional Repression: A Novel Mode of GATA-1 Function. Blood. 109 (12): 5230-3.
  • Arce I, et al. (2004) The human C-type lectin CLECSF8 is a novel monocyte/macrophage endocytic receptor. Eur J Immunol. 34 (1): 210-20.
  • Marshall AS, et al. (2006) Human MICL (CLEC12A) is differentially glycosylated and is down-regulated following cellular activation. Eur J Immunol. 36 (8): 2159-69.
  • Size / Price
    Catalog: MG50946-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"