After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human TGF-beta 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TGFB1cDNA Clone Product Information
cDNA Size:1212
cDNA Description:ORF Clone of Homo sapiens transforming growth factor, beta 1 DNA.
Gene Synonym:CED, DPD1, TGFB, TGFbeta, TGFB1
Restriction Site:HindIII + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Transforming Growth Factor Beta (TGF-beta) Family Related Products
Product nameProduct name
Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Human ALK-2 / ACVR1 Protein (His & Fc Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human TGFBR2 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Human ALK4 / ACVR1B Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinHuman BAMBI / NMA Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human ATF2 Protein (His & GST Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Mouse Smad5 ProteinMouse BAMBI / NMA Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rat Cripto / TDGF1 Protein (Fc Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Cynomolgus TGFBR2 Protein (Fc Tag)Cynomolgus ACVR1B / ALK-4 Protein (Fc Tag)Cynomolgus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)

TGF-beta 1 is a member of the transforming growth factor beta (TGF-beta) family. The transforming growth factor-beta family of polypeptides are involved in the regulation of cellular processes, including cell division, differentiation, motility, adhesion and death. TGF-beta 1 positively and negatively regulates many other growth factors. It inhibits the secretion and activity of many other cytokines including interferon-γ, tumor necrosis factor-alpha and various interleukins. It can also decrease the expression levels of cytokine receptors. Meanwhile, TGF-beta 1 also increases the expression of certain cytokines in T cells and promotes their proliferation, particularly if the cells are immature. TGF-beta 1 also inhibits proliferation and stimulates apoptosis of B cells, and plays a role in controlling the expression of antibody, transferrin and MHC class II proteins on immature and mature B cells. As for myeloid cells, TGF-beta 1can inhibit their proliferation and prevent their production of reactive oxygen and nitrogen intermediates. However, as with other cell types, TGF-beta 1 also has the opposite effect on cells of myeloid origin. TGF-beta 1 is a multifunctional protein that controls proliferation, differentiation and other functions in many cell types. It plays an important role in bone remodeling as it is a potent stimulator of osteoblastic bone formation, causing chemotaxis, proliferation and differentiation in committed osteoblasts. Once cells lose their sensitivity to TGF-beta1-mediated growth inhibition, autocrine TGF-beta signaling can promote tumorigenesis. Elevated levels of TGF-beta1 are often observed in advanced carcinomas, and have been correlated with increased tumor invasiveness and disease progression.

  • Ghadami M, et al. (2000) Genetic Mapping of the Camurati-Engelmann Disease Locus to Chromosome 19q13.1-q13.3. Am J Hum. Genet. 66(1):143-7.
  • Letterio J, et al. (1998) Regulation of immune responses by TGF-beta. Annu Rev Immunol. 16:137-61.
  • Vaughn SP, et al. (2000) Confirmation of the mapping of the Camurati-Englemann locus to 19q13. 2 and refinement to a 3.2-cM region. Genomics. 66(1):119-21.
  • Assoian R, et al. (1983) Transforming growth factor-beta in human platelets. Identification of a major storage site, purification, and characterization. J Biol Chem. 258(11):7155-60.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days
    • Human TGF-beta 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
    Recently Viewed Items