Quick Order

Cynomolgus monkey CD200 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD200cDNA Clone Product Information
cDNA Size:810
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) CD200 molecule DNA.
Gene Synonym:CD200
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

CD200 (OX-2) is a cell surface glycoprotein that imparts immune privileges by suppressing alloimmune and autoimmune responses through its receptor, CD200R, expressed primarily on myeloid cells. Signals delivered through the CD200:CD200R axis have been shown to play an important role in the regulation of anti-tumor immunity, and overexpression of CD200 has been reported in a number of malignancies, including CLL, as well as on cancer stem cells. The role of CD200-CD200R signaling in immune regulation of the central nervous system has become a popular field of research in recent years. Many studies have shown that there is a close correlation between CD200-CD200R, microglia activation, and Parkinson's disease (PD). The ability of CD200 to suppress myeloid cell activation is critical for maintaining normal tissue homeostasis but may also enhance the survival of migratory neoplastic cells. CD200 and CD200R associate via their respective N-terminal Ig-like domains. CD200 has been characterized as an important immunoregulatory molecule, increased expression of which can lead to decreased transplant rejection, autoimmunity, and allergic disease. Elevated CD200 expression has been reported to be associated with poor prognosis in a number of human malignancies. In addition, CD200 also plays an important role in prevention of graft rejection, autoimmune diseases and spontaneous abortion.

  • Minas K, et al. (2006) Is the CD200/CD200 receptor interaction more than just a myeloid cell inhibitory signal? Crit Rev Immunol. 26(3): 213-30.
  • Wang XJ, et al. (2007) CD200-CD200R regulation of microglia activation in the pathogenesis of Parkinson's disease. J Neuroimmune Pharmacol. 2(3): 259-64.
  • Wong KK, et al. (2010) The role of CD200 in immunity to B cell lymphoma. J Leukoc Biol. 88(2): 361-72.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items