After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse TACSTD2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse TACSTD2 cDNA Clone Product Information
Gene_bank_ref_id:NM_020047.3
RefSeq ORF Size:954bp
cDNA Description:Full length Clone DNA of Mus musculus tumor-associated calcium signal transducer 2.
Gene Synonym:Ly97, EGP-1, TROP2, C80403, GA733-1, MGC141612, MGC141613, Tacstd2
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

TROP-2, also referred to as tumor associated calcium signal transducer 2 (TACSTD2), GA733-1 or M1S1, is a cell surface glycoprotein highly expressed in a wide variety of epithelial cancers. In contrast, there is little or no expression of Trop-2 in adult somatic tissue. Because it is a cell surface protein that is selectively expressed in tumor cells, Trop-2 is a potential therapeutic target. The cytoplasmic tail of Trop-2 possesses potential serine and tyrosine phosphorylation sites and a phosphatidyl-inositol binding consensus sequence. Trop-2 transduces an intracellular calcium signal, are consistent with the hypothesis that it acts as a cell surface receptor and support a search for a physiological ligand. TROP2 encoding by an intronless gene was originally defined by the monoclonal antibody GA733, and is a member of a family of at least two type I membrane proteins. The other known member is GA733-2, also called EpCAM and TROP1. It has been suggested by studies that the GA733-1 gene was formed by the retroposition of the GA733-2 gene via an mRNA intermediate.

References
  • Ripani E, et al. (1998) Human Trop-2 is a tumor-associated calcium signal transducer. Int J Cancer. 76(5): 671-6.
  • Wang J, et al. (2008) Identification of Trop-2 as an oncogene and an attractive therapeutic target in colon cancers. Mol Cancer Ther. 7(2): 280-5.
  • Size / Price
    Catalog: MG50922-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"