Quick Order

Text Size:AAA

Mouse PIK3R4 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PIK3R4 cDNA Clone Product Information
Gene_bank_ref_id:BC157947.1
RefSeq ORF Size:4077bp
cDNA Description:Full length Clone DNA of Mus musculus phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 4, p150.
Gene Synonym:C85833, D9Ertd418e, 2210010O15Rik, C730038E05Rik, Pik3r4
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: MG50905-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"