Quick Order

Text Size:AAA

Mouse MUC1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse MUC1 cDNA Clone Product Information
Gene_bank_ref_id:NM_013605.1
RefSeq ORF Size:1896bp
cDNA Description:Full length Clone DNA of Mus musculus mucin 1, transmembrane.
Gene Synonym:EMA, CD227, Muc-1, Muc1
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mMUC1
Restriction Site:HindIII + XbaI (6.1kb + 1.9kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Mucin 1, cell surface associated (MUC1) or polymorphic epithelial mucin (PEM) is a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach and pancreas. MUC-1/CC1/CD227 Exclusively located in the apical domain of the plasma membrane of highly polarized epithelial cells. After endocytosis, internalized and recycled to the cell membrane. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. The alpha subunit has cell adhesive properties. MUC-1/CC1/CD227 Can act both as an adhesion and an anti-adhesion protein. This protein May provide a protective layer on epithelial cells against bacterial and enzyme attack. The beta subunit contains a C-terminal domain which is involved in cell signaling, through phosphorylations and protein-protein interactions. MUC-1/CC1/CD227 participated in modulates signaling in ERK, SRC and NF-kappa-B pathways. In activated T-cells, MUC-1/CC1/CD227 influences directly or indirectly the Ras/MAPK pathway. MUC-1/CC1/CD227 Promotes tumor progression and regulates TP53-mediated transcription and determines cell fate in the genotoxic stress response. Binds, together with KLF4, the PE21 promoter element of TP53 and represses TP53 activity.

References
  • Brayman M, et al. (2004) MUC1: a multifunctional cell surface component of reproductive tissue epithelia. Reprod Biol Endocrinol 2: 4.
  • Schroeder J A, et al. (2001) Transgenic MUC1 interacts with epidermal growth factor receptor and correlates with mitogen-activated protein kinase activation in the mouse mammary gland. J Biol Chem. 276 (16): 13057-64.
  • Li Y, et al. (2001) The epidermal growth factor receptor regulates interaction of the human DF3/MUC1 carcinoma antigen with c-Src and beta-catenin. J Biol Chem. 276 (38): 35239-42.
  • Size / Price
    Catalog: MG50877-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"