After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CCR5 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse CCR5 cDNA Clone Product Information
NCBI RefSeq:NM_009917.5
RefSeq ORF Size:1065bp
cDNA Description:Full length Clone DNA of Mus musculus chemokine (C-C motif) receptor 5.
Gene Synonym:AM4-7, CD195, Cmkbr5, Ccr5
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mCCR5
Restriction Site:KpnI + XbaI (6.1kb + 1.07kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse CCR5 Gene Plasmid Map
Mouse CCR5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Size / Price
Catalog: MG50871-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"