After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse NXPH1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse NXPH1 cDNA Clone Product Information
NCBI RefSeq:NM_008751.5
RefSeq ORF Size:816bp
cDNA Description:Full length Clone DNA of Mus musculus neurexophilin 1.
Gene Synonym:C130005L03Rik, Nxph1
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Neurexophilin-1, or NXPH1 is a secreted glycoprotein, which belongs to the Neurexophilin family. The Neurexophilin family contain at least four genes and resembles a neuropeptide, suggesting a function as an endogenous ligand for alpha-neurexins. The mammalian brains contain four genes for neurexophilins the products of which share a common structure composed of five domains: an N-terminal signal peptide, a variable N-terminal domain, a highly conserved central domain that is N-glycosylated, a short linker region, and a conserved C-terminal domain that is cysteine-rich. Neurexophilin-1 constitutes a secreted cysteine-rich glycoprotein, forms a very tight complex with alpha neurexins, a group of proteins that promote adhesion between dendrites and axons. Neurexophilins 1 and 3 but not 4 (neurexophilin 2 is not expressed in rodents) bind to a single individual LNS domain, the second overall LNS domain in all three alpha-neurexins.

References
  • Missler M, et al. (1998) Neurexophilin binding to alpha-neurexins. A single LNS domain functions as an independently folding ligand-binding unit. J Biol Chem. 273(52): 34716-23.
  • Missler M, et al. (1998) Neurexophilins form a conserved family of neuropeptide-like glycoproteins. J Neurosci. 18(10): 3630-8.
  • Petrenko AG, et al. (1996) Structure and evolution of neurexophilin. J Neurosci. 16(14): 4360-9.
  • Size / Price
    Catalog: MG50865-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"