Quick Order

Mouse CCR2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CCR2 cDNA Clone Product Information
Gene_bank_ref_id:NM_009915.2
RefSeq ORF Size:1122bp
cDNA Description:Full length Clone DNA of Mus musculus chemokine (C-C motif) receptor 2.
Gene Synonym:Ckr2, Ccr2a, Ccr2b, Ckr2a, Ckr2b, mJe-r, Cmkbr2, Cc-ckr-2, Ccr2
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mCCR2
Restriction Site:KpnI + XbaI (6.1kb + 1.12kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Size / Price
Catalog: MG50853-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"