After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MICB Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MICBcDNA Clone Product Information
cDNA Size:1152
cDNA Description:ORF Clone of Homo sapiens MHC class I polypeptide-related sequence B DNA.
Gene Synonym:PERB11.2, MICB
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

MHC class I polypeptide-related sequence B, also known as MICB, is a heavily glycosylated protein serving as a ligand for the type I I receptor NKG2D. MICB shares 85% amino acid identity with MICA, a closely related protein, both of which contain three extracellular immunoglobulin-like domains, but without capacity to bind peptide or interact with beta-2-microglobulin. acting as a stress-induced self-antigen, binding of MICB to the NKG2D receptor activates the cytolytic response of natural killer (NK) cells, CD8+αβ T cells, and γδ T cells on which the receptor is expressed. MICA/B are minimally expressed on normal cells, but are frequently expressed on epithelial tumors and can be induced by bacterial and viral infections. MICA/B recognition thus is involved in tumor surveillance, viral infections, and autoimmune diseases.

  • Bauer, S. et al., 1999, Science. 285:727-729.
  • Braud, V.M. et al., 1999, Curr. Opin. Immunol. 11: 100-108.
  • Groh, V. et al., 2001, Nature Immunol. 2: 255-260.
  • Stephens, H., 2001, Trends Immunol. 22: 378-385.
  • Borrego, F. et al., 2002, Mol. Immunol. 38: 637–660.
  • Groh, V. et al., 2002, Nature. 419:734-738.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks