Quick Order

Text Size:AAA

Mouse IL10Rb natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse IL10RB cDNA Clone Product Information
Gene_bank_ref_id:NM_008349.4
RefSeq ORF Size:1057bp
cDNA Description:Full length Clone DNA of Mus musculus interleukin 10 receptor, beta.
Gene Synonym:Crfb4, CRF2-4, Il10r2, D21S58h, IL-10R2, AI528744, D16H21S58, 6620401D04Rik
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Background

Interleukin 10 receptor, beta subunit (IL10RB/IL-10RB) also known as Cytokine receptor family 2 member 4, Interleukin-10 receptor subunit 2, and cytokine receptor family II, member 4, is a subunit for the interleukin-10 receptor. IL10RB/IL-10RB belongs to the cytokine receptor family. It is an accessory chain essential for the active interleukin 10 receptor complex. Coexpression of this and IL10RA proteins has been shown to be required for IL10-induced signal transduction. Defects in IL10RB/IL-10RB are the cause of inflammatory bowel disease type 25 (IBD25). It is a chronic, relapsing inflammation of the gastrointestinal tract with a complex etiology. It is subdivided into Crohn disease and ulcerative colitis phenotypes. Crohn disease may affect any part of the gastrointestinal tract from the mouth to the anus, but most frequently it involves the terminal ileum and colon. Bowel inflammation is transmural and discontinuous; it may contain granulomas or be associated with intestinal or perianal fistulas. In contrast, in ulcerative colitis, the inflammation is continuous and limited to rectal and colonic mucosal layers; fistulas and granulomas are not observed. Both diseases include extraintestinal inflammation of the skin, eyes, or joints.

References
  • Josephson K, et al. (2001) Crystal structure of the IL-10/IL-10R1 complex reveals a shared receptor binding site. Immunity. 15 (1): 35-46.
  • Yoo KH, et al. (2011) Association of IL10, IL10RA, and IL10RB polymorphisms with benign prostate hyperplasia in Korean population. J Korean Med Sci. 26(5): 659-64.
  • Size / Price
    Catalog: MG50846-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"