After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse SPOCK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SPOCK1cDNA Clone Product Information
cDNA Size:1329
cDNA Description:ORF Clone of Mus musculus sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1 DNA.
Gene Synonym:Spock, Ticn1, testican, Spock1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Osteonectin, also known as SPOCK1, is an extracellular heparan/chondroitin sulfate proteoglycan. Members of this family are known as testicans, also called SPOCKs. They are characterized structurally by an N-terminal testican-specific domain, a follistatin-like region, a calcium-binding domain, a thyroglobulin-like domain, and an acidic C-terminal domain with two putative glycosaminoglycan attachment sites. SPOCKs are enriched in brain and have been shown to regulate neuronal attachment and outgrowth. They contain inhibitory regions in several domains targeted to different classes of protease, and in some cases may act as protease inhibitors. Osteonectin contains 1 Kazal-like domain and 1 thyroglobulin type-1 domain. Up to now, little is known about osteonectin’s function. It may play a role in cell-cell and cell-matrix interactions. Osteonectin also may contribute to various neuronal mechanisms in the central nervous system.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items