After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSKcDNA Clone Product Information
cDNA Size:1353
cDNA Description:ORF Clone of Homo sapiens c-src tyrosine kinase DNA.
Gene Synonym:MGC117393, CSK
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10740-ACG$325
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10740-ACR$325
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10740-ANG$325
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10740-ANR$325
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10740-CF$295
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10740-CH$295
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10740-CM$295
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10740-CY$295
Human CSK Gene cDNA Clone (full-length ORF Clone)HG10740-M$195
Human CSK Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10740-M-F$395
Human CSK Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10740-M-N$395
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10740-NF$295
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10740-NH$295
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10740-NM$295
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10740-NY$295
Human CSK Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10740-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

The tyrosine kinase c-Src has been implicated as a modulator of cell proliferation, spreading, and migration. These functions are also regulated by Met. The structure of a large fragment of the c-Src kinase comprises the regulatory and kinase domains and the carboxy-terminal tall. c-Src kinase interactions among domains and is stabilized by binding of the phosphorylated tail to the SH2 domain. This molecule is locked in a conformation that simultaneously disrupts the kinase active site and sequesters the binding surfaces of the SH2 and SH3 domains. The structure shows how appropriate cellular signals, or transforming mutations in v-Src, could break these interactions to produce an open, active kinase. The protein-tyrosine kinase activity of c-Src kinase is inhibited by phosphorylation of tyr527, within the c-Src c-terminal tail. Genetic and biochemical data have suggested that this negative regulation requires an intact Src homology 2 (SH2) domain. Since SH2 domains recognize phosphotyrosine, it is possible that these two non-catalytic domains associate, and thereby repress c-Src kinase activity. Experiments have suggested that c-Src kinase plays a role in the biological behaviour of colonic carcinoma cells induced by migratory factors such as EGF, perhaps acting in conjunction with FAK to regulate focal adhesion turnover and tumour cell motility. Furthermore, although c-Src kinase has been implicated in colonic tumour progression, in the adenoma to carcinoma in vitro model c-Src is not the driving force for this progression but co-operates with other molecules in carcinoma development.


  • Brauninger A. et al.,1992, Gene. 110: 205-11.
  • Sondhi D. et al., 1999, Biochemistry. 38 (34): 11147-55.
  • Ogawa A. et al., 2002, J Biol Chem. 277 (17): 14351-4.
  • Cole PA. et al., 2003, Curr Opin Chem Biol. 7 (5): 580-5.
  • Baumeister U. et al., 2005,EMBO J. 24 (9): 1686-95.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items