Quick Order

Text Size:AAA

Mouse KLRB1A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KLRB1AcDNA Clone Product Information
cDNA Size:702
cDNA Description:ORF Clone of Mus musculus killer cell lectin-like receptor subfamily B member 1A DNA.
Gene Synonym:Ly55a, NKRP12, Nkrp1a, NKR-P1A, Nkrp1-a, Klrb1a
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
  • Plougastel B, et al. (2001) Analysis of a 1-Mb BAC contig overlapping the mouse Nkrp1 cluster of genes: cloning of three new Nkrp1 members, Nkrp1d, Nkrp1e, and Nkrp1f. Immunogenetics 53: 592-598.
  • Kogelberg H, et al. (2000) Expression in Escherichia coli, folding in vitro, and characterization of the carbohydrate recognition domain of the natural killer cell receptor NKR-P1A. Protein Expr Purif. 20(1): 10-20.
  • Grazia Cifone M, et al. (1997) NKR-P1A stimulation of arachidonate-generating enzymes in rat NK cells is associated with granule release and cytotoxic activity. J Immunol. 159(1): 309-17.
  • Josien R, et al. (1997) Rat spleen dendritic cells express natural killer cell receptor protein 1 (NKR-P1) and have cytotoxic activity to select targets via a Ca2+-dependent mechanism. J Exp Med. 186: 467-472.
  • Ryan JC, et al. (1995) NKR-P1A is a target-specific receptor that activates natural killer cell cytotoxicity. J Exp Med. 181(5): 1911-5.
  • Lanier L L, et al. (1994) Human NKR-P1A: a disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes. J Immunol. 153: 2417-2428.
  • Chambers W, et al. (1989) Monoclonal antibody to a triggering structure expressed on rat natural killer cells and adherent lymphokine-activated killer cells. J Exp Med. 169: 1373-1389.