Quick Order

Mouse CD160 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CD160 cDNA Clone Product Information
Gene_bank_ref_id:NM_001163496.1
RefSeq ORF Size:558bp
cDNA Description:Full length Clone DNA of Mus musculus CD160 antigen.
Gene Synonym:By55, AU045688, Cd160
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CD160 antigen, also known as Natural killer cell receptor BY55 and CD160, is a cell membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. CD160 is a GPI-anchored lymphocyte surface receptor in which expression is mostly restricted to the highly cytotoxic CD56(dim)CD16(+) peripheral blood NK subset. CD160 is a receptor showing broad specificity for both classical and non-classical MHC class I molecules. CD160 is expressed in spleen, peripheral blood, and small intestine. Expression of CD160 is restricted to functional NK and T cytotoxic lymphocytes. CD160 acts as a co-activator receptor for CD3-induced proliferation of CD4+ CD160+ T cells isolated from inflammatory skin lesions. Unique CD4+ CD160+ lymphocyte subset may play a role in the pathogenesis of skin inflammation. Activated NK lymphocytes release a soluble form of CD160 that functionally impairs the MHC-I-specific cytotoxic CD8(+) T lymphocyte responsiveness.

References
  • Barakonyi A. et al., 2004, J Immunol.173 (9): 5349-54.
  • Rabot M. et al., 2006, Transpl Immunol. 17 (1): 36-8.
  • Abecassis S. et al., 2007, J Invest Dermatol. 127?(5): 1161-6.
  • Giustiniani J.?et al., 2007, J Immunol. 178 (3): 1293-300.
  • Size / Price
    Catalog: MG50805-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"