Quick Order

Mouse PDGFB natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PDGFB cDNA Clone Product Information
Gene_bank_ref_id:NM_011057.3
RefSeq ORF Size:726bp
cDNA Description:Full length Clone DNA of Mus musculus platelet derived growth factor, B polypeptide.
Gene Synonym:Sis, PDGF-B, Pdgfb
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mPDGFB
Restriction Site:KpnI + XbaI (6.1kb + 0.73kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 48 T/C and 321 T/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Size / Price
Catalog: MG50801-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"