Quick Order

Mouse DDC natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse DDC cDNA Clone Product Information
Gene_bank_ref_id:NM_001190448.1
RefSeq ORF Size:1443bp
cDNA Description:Full length Clone DNA of Mus musculus dopa decarboxylase.
Gene Synonym:Aadc, Ddc
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Dopa Decarboxylase (DDC), also known as AADC and Aromatic-L-amino acid decarboxylase, is a 54 kDa member of the group II decarboxylase family of proteins.It is a vitamin B6-dependent homodimeric enzyme that catalyzes the decarboxylation of both L-3,4-dihydroxyphenylalanine (L-DOPA) and L-5-hydroxytryptophan to dopamine and serotonin, respectively, which are major mammalian neurotransmitters and hormones belonging to catecholamines and indoleamines. Since L-DOPA is regularly used to treat the symptoms of Parkinson's disease, the catalytic pathway is of particular research interest. Defects of DDC are associated with severe developmental delay, oculogyric crises (OGC), as well as autosomal recessive disorder AADC deficiency, an early onset inborn error in neurotransmitter metabolism which can lead to catecholamine and serotonin deficiency.

References
  • Ichinose, H. et al.,1989,Biochem. Biophys. Res. Commun. 164: 1024-1030.
  • Lisa, J. S. et al., 1992, Genomics 13: 469-471.
  • Moore, P. S. et al.,1996, Biochem. J. 315:249-256.
  • Bertoldi, M. et al., 2003, Biochim. Biophys. Acta. 1647:42-47.
  • Vassilacopoulou, D. et al., 2004, Neurochem. Res. 29: 1817-1823.
  • Ma, J.Z., et al., 2005, Hum. Mol. Genet. 14: 1691-1698.
  • Size / Price
    Catalog: MG50799-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"