Quick Order

Text Size:AAA

Human CDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDK4cDNA Clone Product Information
cDNA Size:912
cDNA Description:ORF Clone of Homo sapiens cyclin-dependent kinase 4 DNA.
Gene Synonym:CMM3, PSK-J3, MGC14458, CDK4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CDK4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Related Products
Product nameProduct name

CDK4 is a member of the Ser/Thr protein kinase family. It is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of CDK4 is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). CDK4 was shown to be responsible for the phosphorylation of retinoblastoma gene product. CDK4 is the ser/Thr-kinase component of cyclin D-CDK4 (DC) complexes that phosphorylate and inhibit members of the retinoblastoma (RB) protein family including RB1 and regulate the cell-cycle during G(1)/S transition. Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB/E2F complexes and the subsequent transcription of E2F target genes which are responsible for the progression through the G(1) phase. Hypophosphorylates RB1 in early G(1) phase. Cyclin D-CDK4 complexes are major integrators of various mitogenenic and antimitogenic signals. CDK4 has been shown to be mutated in some types of cancer, whilst a chromosomal rearrangement can lead to Cdk6 overexpression in lymphoma, leukemia and melanoma.

  • Stepanova L, et al. (1996) Mammalian p50Cdc37 is a protein kinase-targeting subunit of Hsp90 that binds and stabilizes Cdk4. Genes Dev. 10(12):1491-502.
  • Lamphere L, et al. (1997) Interaction between Cdc37 and Cdk4 in human cells. Oncogene. 14(16): 1999-2004.
  • Dai K, et al. (1996) Physical interaction of mammalian CDC37 with CDK4. J Biol Chem. 271(36): 22030-4.
  • Sugimoto M, et al. (1999) Regulation of CDK4 activity by a novel CDK4-binding protein, p34SEI-1. Genes Dev. 13(22):3027-33.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items