Quick Order

Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
OXSR1cDNA Clone Product Information
cDNA Size:1584
cDNA Description:ORF Clone of Homo sapiens oxidative-stress responsive 1 DNA.
Gene Synonym:OSR1, KIAA1101, OXSR1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10727-ACG$345
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10727-ACR$345
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10727-ANG$345
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10727-ANR$345
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10727-CF$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10727-CH$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10727-CM$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10727-CY$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone)HG10727-M$115
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10727-M-F$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG10727-M-N$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10727-NF$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10727-NH$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10727-NM$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10727-NY$315
Human OXSR1 / OSR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10727-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Oxidative stress-responsive 1 protein (OXSR1), also known as Serine/threonine-protein kinase OSR1, is a member of the Ser/Thr protein kinase family of proteins. OXSR1 regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton. OXSR1 is a 58 kDa protein of 527 amino acids that is widely expressed in mammalian tissues and cell lines. The amino acid (aa) sequence of the predicted OXSR1 protein is 39% identical to that of human SOK1. Of potential regulators surveyed, endogenous OXSR1 is activated only by osmotic stresses, notably sorbitol and to a lesser extent NaCl. OXSR1 did not increase the activity of coexpressed JNK, nor did it activate three other MAPKs, p38, ERK2, and ERK5. Phosphorylation by OXSR1 modulates the G protein sensitivity of PAK isoforms. The OXSR1 and SPAK are key enzymes in a signalling cascade regulating the activity of Na+/K+/2Cl- co-transporters (NKCCs) in response to osmotic stress. Both kinases have a conserved carboxy-terminal (CCT) domain, which recognizes a unique peptide (Arg-Phe-Xaa-Val) motif. The OXSR1 and SPAK kinases specifically recognize their upstream activators and downstream substrates.

Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items