After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse VCL natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse VCL cDNA Clone Product Information
Gene_bank_ref_id:NM_009502.4
RefSeq ORF Size:3201bp
cDNA Description:Full length Clone DNA of Mus musculus Vinculin.
Gene Synonym:Metavinculin
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Vinculin (VCL) is a cytoskeletal protein that is closely related to both cell-matrix interactions and cell-cell junctions. VCL is a membrane-cytoskeletal protein in focal adhesion plaques that is involved in linkage of integrin adhesion molecules to the actin cytoskeleton. The protein contains an acidic N-terminal domain and a basic C-terminal domain separated by a proline-rich middle segment. This protein has multi-ligand properties and has been found to interact with a number of microfilament associated proteins, such as talin, a-actinin, and paxillin, which reportedly bind to either the head or tail domains of vinculin.

References
  • Massoumi R, et al. (2001) Leukotriene D(4) affects localisation of vinculin in intestinal epithelial cells via distinct tyrosine kinase and protein kinase C controlled events. J Cell Sci. 114(10): 1925-34.
  • Turner CE, et al. (1994) Primary sequence of paxillin contains putative SH2 and SH3 domain binding motifs and multiple LIM domains: identification of a vinculin and pp125Fak-binding region. J Cell Sci. 107 (6): 1583-91.
  • Strasser P, et al. (1993) Variable and constant regions in the C-terminus of vinculin and metavinculin: cloning and expression of fragments in E. coli. FEBS Lett. 317: 189-194.
  • Size / Price
    Catalog: MG50773-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"