Quick Order

Cynomolgus monkey CDH17 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus CDH17 cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:2499bp
cDNA Description:Full length Clone DNA of Macaca mulatta cadherin 17, LI cadherin (liver-intestine) with N terminal Flag tag.
Gene Synonym:CDH17
Species:Cynomolgus
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Cadherin-17 or LI-cadherin is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Cadherin-17/LI-cadherin is a cadherin-like protein consisting of an extracellular region, 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing of the encoding gene results in multiple transcript variants. Cadherin-17/LI-cadherin preferentially interact with themselves in a homophilic manner in connecting cells. Cadherin-17 may thus contribute to the sorting of heterogeneous cell types and have a role in the morphological organization of liver and intestine. It's also involved in intestinal peptide transport. Experiments have reported the association between Cadherin-17/LI-cadherin and gastric cancer. Cadherin-17/LI-cadherin expression was detected in 63/94 of gastric adenocarcinomas in addition to intestinal metaplasia. The expression of Cadherin-17 tended to be associated with intestinal type carcinoma, and carcinomas with Cadherin-17 expression was significantly more frequent in advanced stage cases than in early stage. Cadherin-17 is also a useful immunohistochemical marker for diagnosis of adenocarcinomas of the digestive system.

References
  • Liu LX, et al. (2009) Targeting cadherin-17 inactivates Wnt signaling and inhibits tumor growth in liver carcinoma. Hepatology. 50(5): 1453-63.
  • Ito R, et al. (2005) Clinicopathological significant and prognostic influence of cadherin-17 expression in gastric cancer. Virchows Arch. 447(4): 717-22.
  • Horsfield J, et al. (2002) Cadherin-17 is required to maintain pronephric duct integrity during zebrafish development. Mech Dev. 115(1-2): 15-26.
  • Size / Price
    Catalog: CG90147-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"