Quick Order

Mouse CTSS natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CTSS cDNA Clone Product Information
Gene_bank_ref_id:AF038546.1
RefSeq ORF Size:1023bp
cDNA Description:Full length Clone DNA of Mus musculus cathepsin S.
Gene Synonym:Ctss
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Cathepsin S (CTSS), one of the lysosomal proteinases, has many important physiological functions in the nervous system, especially in process of extracellular matrix degradation and endocellular antigen presentation. CTSS is synthesized as inactive precursor of 331 amino acids consisting of a 15-aa signal peptide, a propeptide of 99 aa, and a mature polypeptide of 217 aa. It is activated in the lysosomes by a proteolytic cleavage of the propeptide. Cathepsin S is expressed in the lysosome of antigen presenting cells, primarily dendritic cells, B-cells and macrophages. Compared with other lysosomal cysteine proteases, cathepsin S has displayed some unique characteristics. Cathepsin S is most well known for its critical function in the proteolytic digestion of the invariant chain chaperone molecules, thus controlling antigen presentation to CD4+ T-cells by major histocompatibility complex (MHC) class II molecules or to NK1.1+ T-cells via CD1 molecules. Cathepsin S also appears to participate in direct processing of exogenous antigens for presentation by MHC class II to CD4+ T-cells, or in cross-presentation by MHC class I molecules to CD8+ T-cells. In addition, although direct evidence is still lacking, in its secreted form cathepsin S is implicated in degradation of the extracellular matrix, which may contribute to the pathology of a number of diseases, including arthritis, atherosclerosis, neurological diseases and chronic obstructive pulmonary disease.

References
  • Liu W, et al. (2004) Cysteine protease cathepsin S as a key step in antigen presentation. Drug News Perspect. 17(6): 357-63.
  • Thurmond RL, et al. (2005) Cathepsin S inhibitors as novel immunomodulators. Curr Opin Investig Drugs. 6(5): 473-82.
  • Wang DM, et al. (2008) Cathepsin S in pathogenesis of neurological diseases. Zhejiang Da Xue Xue Bao Yi Xue Ban. 37(4): 422-6.
  • Size / Price
    Catalog: MG50769-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"