After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CAR10 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CA10 cDNA Clone Product Information
Gene_bank_ref_id:NM_028296.3
RefSeq ORF Size:987bp
cDNA Description:Full length Clone DNA of Mus musculus carbonic anhydrase 10.
Gene Synonym:Ca10, BB085816, 2700029L05Rik, Car10
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Carbonic anhydrase X, also called carbonic anhydrase - related protein X (CARPX) and CA10, belongs to the CA family of zinc metalloenzymes which catalyze the reversible hydration of carbon dioxide in various biological processes such as respiration, renal tubular acidification and bone resorption. The secreted protein CARPX without CA activity (hydration of CO2) is identified as an acatalytic member of the alpha-carbonic anhydrase subgroup. CARP X expression is detected in the adult total brain and almost all parts of the central nervous system, but not in the fetal brain. Accordingly, CARP X is suggested to play a role in the development of central nervous system, especially the brain. The same CARP X protein are encoded by multiple transcript variants of this gene.

References
  • Okamoto, N. et al., 2001, Biochim. Biophys. Acta 1518:311-316.
  • Taniuchi, K. et al., Neuroscience 112: 93-99.
  • Supuran, C.T. et al., 2003, Med. Res. Rev. 23: 146-189.
  • Size / Price
    Catalog: MG50768-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"