After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CAR8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CA8cDNA Clone Product Information
cDNA Size:876
cDNA Description:ORF Clone of Mus musculus carbonic anhydrase 8 DNA.
Gene Synonym:Ca8, wdl, Cals, Carp, Cals1, AW546993, Car8
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase protein (CA) VIII, which is a member of the CA gene family, has been shown to have no catalytic CA activity and its biological function is still unknown. Increased expression of CA-RP VIII was observed in 78% of colorectal carcinomas. It suggested that CA-RP VIII plays a role in the process of invasion in colorectal cancer.

  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Miyaji E, et al. (2003) Overexpression of carbonic anhydrase-related protein VIII in human colorectal cancer. The Journal of Pathology. 201(1): 37-45.