Quick Order

Mouse LILRA5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LILRA5cDNA Clone Product Information
cDNA Size:888
cDNA Description:ORF Clone of Mus musculus leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 DNA.
Gene Synonym:Gm4878, Lilrc1, EG232801, E030017K20, Lilra5
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

LILRA5 is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LILR are a family of receptors possessing extracellular immunoglobulin domains. They are also known as CD85, ILTs and LIR, and can exert immunomodulatory effects on a wide range of immune cells. ILT-11 contains 2 Ig-like C2-type (immunoglobulin-like) domains. It can be detected n tissues of the hematopoietic system, including bone marrow, spleen, lymph node and peripheral leukocytes. Crosslink of ILT-11 on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses.

  • Wende H, et al. (2000) Extensive gene duplications and a large inversion characterize the human leukocyte receptor cluster. Immunogenetics. 51(8-9):703-13.
  • Jones DC, et al. (2009) Alternative mRNA splicing creates transcripts encoding soluble proteins from most LILR genes. Eur J Immunol. 39(11):3195-206.
  • Mosbruger TL, et al. (2010) Large-scale candidate gene analysis of spontaneous clearance of hepatitis C virus. J Infect Dis. 201(9):1371-80.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items