Quick Order

Mouse SMPD1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse SMPD1 cDNA Clone Product Information
NCBI RefSeq:NM_011421.2
RefSeq ORF Size:1884bp
cDNA Description:Full length Clone DNA of Mus musculus sphingomyelin phosphodiesterase 1, acid lysosomal.
Gene Synonym:ASM, aSMase, A-SMase, Zn-SMase, Smpd1
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Sphingomyelin phosphodiesterase 1 (SMPD1) , also known as ASM ( acid sphingomyelinase ), is a member of the acid sphingomyelinase family of enzymes. Three isoforms have been identified, isoform 1 is 631 amino acids (aa) in length as the pro form, while Isoform 2 and isoform 3 have lost catalytic activity. The active SMPD1 isoform 1 contains one saposin B-type domain that likely interacts with sphingomyelin, and a catalytic region. Human SMPD1 is 86% aa identical to mouse SMPD1. SMPD1 is a monomeric lysosomal enzyme that converts sphingomyelin (a plasma membrane lipid ) into ceramide through the removal of phosphorylcholine. This generates second messenger components that participate in signal transduction. Defects in SMPD1 are the cause of Niemann-Pick disease type A (NPA) and type B (NPB), also known as Niemann-Pick disease classical infantile form and Niemann-Pick disease visceral form. Niemann-Pick disease is a clinically and genetically heterogeneous recessive disorder. NPB has little if any neurologic involvement and patients may survive into adulthood.

Size / Price
Catalog: MG50749-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"