After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CD82 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CD82 cDNA Clone Product Information
NCBI RefSeq:NM_001136055.1
RefSeq ORF Size:801bp
cDNA Description:Full length Clone DNA of Mus musculus CD82 antigen.
Gene Synonym:C33, Kai1, Tspan27, AA682076, AL023070, Cd82
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CD82, also known as KAI-1, structurally belongs to tetraspanin family while categorised as metastasis suppressor gene on functional grounds. KAI1/CD82 is localized on cell membrane and form interactions with other tetraspanins, integrins and chemokines which are respectively responsible for cell migration, adhesion and signalling. Downregulation of CD82 expression is associated with the advanced stages of many human cancers and correlates with the acquisition of metastatic potential. Recent studies suggest that complex mechanisms underlie CD82 loss of function, including altered transcriptional regulation, splice variant production and post-translational protein modifications, and indicate a central role for CD82 in controlling metastasis as a 'molecular facilitator'. The loss of KAI1/CD82 expression in invasive and metastatic cancers is due to a complex, epigenetic mechanism that probably involves transcription factors such as NFkappaB, p53, and beta-catenin. A loss of KAI1 expression is also associated with the advanced stages of many human malignancies and results in the acquisition of invasive and metastatic capabilities by tumour cells. Thus, KAI1/CD82 is regarded as a wide-spectrum tumor metastasis suppressor.

References
  • Malik FA, et al. (2009) KAI-1/CD82, the molecule and clinical implication in cancer and cancer metastasis. Histol Histopathol. 24(4): 519-30.
  • Liu WM, et al. (2006) KAI1/CD82, a tumor metastasis suppressor. Cancer Lett. 240(2): 183-94.
  • Tonoli H, et al. (2006) CD82 metastasis suppressor gene: a potential target for new therapeutics? Trends Mol Med. 11(12): 563-70.
  • Jackson P, et al. (2005) KAI1 tetraspanin and metastasis suppressor. Int J Biochem Cell Biol. 37(3): 530-4.
  • Size / Price
    Catalog: MG50744-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"