After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CD69 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CD69 cDNA Clone Product Information
NCBI RefSeq:NM_001033122.3
RefSeq ORF Size:600bp
cDNA Description:Full length Clone DNA of Mus musculus CD69 antigen.
Gene Synonym:AIM, VEA, AI452015, 5830438K24Rik, Cd69
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Early activation antigen CD69, also known as activation inducer molecule (AIM), is a single-pass type II membrane protein. Recently, cDNA clones encoding human and mouse CD69 were isolated and showed CD69 to be a member of the C-type lectin superfamily. It is one of the earliest cell surface antigens expressed by T cells following activation. Once expressed, CD69 acts as a costimulatory molecule for T cell activation and proliferation. In addition to mature T cells, CD69 is inducibly expressed by immature thymocytes, B cells, natural killer (NK) cells, monocytes, neutrophils and eosinophils, and is constitutively expressed by mature thymocytes and platelets. CD69 is involved in lymphocyte proliferation and functions as a signal transmitting receptor in lymphocytes, natural killer (NK) cells, and platelets. The structure, chromosomal localization, expression and function of CD69 suggest that it is likely a pleiotropic immune regulator , potentially important in the activation and differentiation of a wide variety of hematopoietic cells. This membrane molecule transiently expresses on activated lymphocytes, and its selective expression in inflammatory infiltrates suggests that it plays a role in the pathogenesis of inflammatory diseases. CD69 plays a crucial role in the pathogenesis of allergen-induced eosinophilic airway inflammation and hyperresponsiveness and that CD69 could be a possible therapeutic target for asthmatic patients.

References
  • Ziegler SF, et al. (1994) The activation antigen CD69. Stem Cells. 12(5): 456-65.
  • Marzio R, et al. (1999) CD69 and regulation of the immune function. Immunopharmacol Immunotoxicol. 21(3): 565-82.
  • Lamana A, et al. (2006) The role of CD69 in acute neutrophil-mediated inflammation. Eur J Immunol. 36(10): 2632-8.
  • Miki-Hosokawa T, et al. (2009) CD69 controls the pathogenesis of allergic airway inflammation. J Immunol. 183(12): 8203-15.
  • Size / Price
    Catalog: MG50731-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"