Quick Order

Mouse CD26 / DPP4 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse DPP4 cDNA Clone Product Information
NCBI RefSeq:NM_001159543.1
RefSeq ORF Size:2190bp
cDNA Description:Full length Clone DNA of Mus musculus dipeptidylpeptidase 4.
Gene Synonym:Cd26, THAM, Dpp-4, Dpp4
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Dipeptidyl peptidase-4 (DPP4) or adenosine deaminase complexing protein 2 (ADCP 2) or T-cell activation antigen CD26 is a serine exopeptidase belonging to the S9B protein family that cleaves X-proline dipeptides from the N-terminus of polypeptides, such as chemokines, neuropeptides, and peptide hormones. The enzyme is a type II transmembrane glycoprotein, expressed on the surface of many cell types. It is also present in serum and other body fluids in a truncated form (sCD26/DPPIV). The soluble CD26 (sCD26) as a tumour marker for the detection of colorectal cancer (CRC) and advanced adenomas. As both a regulatory enzyme and a signalling factor, DPP4 has been evaluated and described in many studies. DPP4 inhibition results in increased blood concentration of the incretin hormones glucagon-like peptide-1 (GLP-1) and gastric inhibitory polypeptide (GIP). This causes an increase in glucose-dependent stimulation, resulting in a lowering of blood glucose levels. Recent studies have shown that DPP4 inhibitors can induce a significant reduction in glycosylated haemoglobin (HbA(1c)) levels, either as monotherapy or as a combination with other antidiabetic agents. Research has also demonstrated that DPP4 inhibitors portray a very low risk of hypoglycaemia development, and are a new pharmacological class of drugs for treating Type 2 diabetes.

References
  • Doupis J, et al. (2008) DPP4 inhibitors: a new approach in diabetes treatment. Adv Ther. 25(7): 627-43.
  • Havre PA, et al. (2008) The role of CD26/dipeptidyl peptidase IV in cancer. Front Biosci. 13: 1634-45.
  • De Chiara L, et al. (2009) Soluble CD26 levels and its association to epidemiologic parameters in a sample population. Dis Markers. 7(6): 311-6.
  • Matteucci E, et al. (2009) Dipeptidyl peptidase-4 (CD26): knowing the function before inhibiting the enzyme. Curr Med Chem. 16(23): 2943-51.
  • Size / Price
    Catalog: MG50718-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"